Kids Corner – Key Concepts

• Look up to the stars – what are they and how did we get here?
  Scientists and philosophers used Maths to predict what things are made of (quarks, atoms, electrons, all elements, stars and planets).
  
  
• We think that 14 billion years ago the universe sprang into being (The Big Bang).  Just after this nearly all ‘matter’ was just hydrogen atoms, this is what makes up the sun and powers our world with it’s nuclear reaction (turning hydrogen into helium).
  
  
• When you look up to the stars you can see, (mainly), just single stars 'relatively' close to our solar system. The furthest star that we can see with the naked eye is Denibe which is about 1,550 light years away. (And the speed of light is 670,616,629 miles per hour or about 671 million miles per hour rounded up)
  
  
• We can also see (unaided) the Andromeda galaxy which is a massive 2.5 million light years away from us. The only other galaxy we can see unaided is the Magellanic clouds (Large and Small) which is about 75,000 light years away.

• The solar system is part of our own galaxy - called the Milky Way. On a clear night you can see a great swathe of stars that make up some of the milky way. At the centre is (we think) is a supermassive black hole. Around it swarm more than a 100 Billion stars (and probably several times that number of planets).
  

• Water is made of hydrogen atoms and oxygen atoms (H2O).  All of this hydrogen was created just after the big bang – so we are made up of hydrogen that is 14 billion years old!
  

• We also used maths to predict how things work – gravity, movement, guitars, electricity, nuclear power, iphones etc.

• Elements - these are the basic building blocks created within the stars. They consist of protons & neutrons at the centre of atoms, (the nucleus), and around this nucleus the electrons.

• The elements from Hydrogen, (which has just one proton and one electron), to iron are produced in small and larger stars, the heavier elements (Cobalt to Uranium) are produced in exploding massive stars (called Supernova).
  

• Chemistry – elements joining together (via their electrons) producing everything else, including all life.
  

• Life – all of it – based on a ‘simple’ program (DNA) of four chemical units (CTGA), these combine to create just 20 amino acids and these create ALL proteins that make cells, bone, brains etc.

• There is one short piece of DNA (GTGCCAGCAGCCGCGGTAATTCCAGC TCCAATAGCGTATATTAAAGTTGCTGCAGTTAAAAAG) that is in ALL life. That includes all of us and all animals and even all bacteria. This piece of DNA was thought to come from the first simple life form that we have all come from (some 3.5 Billions years ago this common life form has been named LUCA).

• Scale of Life – started 3.5 billion years ago, that’s nearly one third of the time from the start of the universe (we think).  That’s quite amazing – life is really very old on the total scale of the universe.

• This is a long time - to put it into context, our Galaxy is about 160,000 light years across (that means light takes 160,000 years to cross it) and our solar system has orbited around the galaxy about 15 times since life first began!
  

• However, for about 2 Billion years - there was NOTHING more than bacteria (very small single cell organisms). Then, perhaps as a result of an amazing chance, two types of bacteria got together, (one ingested the other), and instead of destroying one of them they created together a new type of organism (eukaryotic cell). All the rest of (multi-cellular) life came from that single chance meeting!

• Human Life – very new on this timescale – and we are the only animal to create technology.

• Brains – How do we ‘think’ – we still have very little idea!
  

• Human Behaviour – based on very old natural processes that come from way back in our ancestry – the apes and beyond, many millions of years in development. We think that communication and social interaction in early humanoids helped us to become more intelligent.
  

• Human ascent – through technological progress, we did things quicker and better due to technology and outpaced the development of other species in a very short time. 
  

• Modern humans came from a small group (in Africa) just a hundred thousand years ago.  We are all very, very similar (our DNA), there is more (genetic) difference in just one group of monkeys than within the whole human race.
  

• Society – social interactions are firmly based on built-in human nature – developed while we were apes and before.
  

• Smart or Clever? Well consider the mess we have made of the world, (wars, slavery, cruelty, famine, obesity, using up of finite resources), while humans are clever technically, we are not smart at planning for future success.  Human societies are driven, in the main, by old human instincts.
  

• Technology – food production, weapons, housing, transport, heating, lighting, and communications – all have continued to advance over thousands of years. 
  

• Not just these, but the technologies of money, social & educational systems, economic & political structures including all of our laws – these are all just man-made technologies - although we rarely think of them as such.
  

• The main technical changes started with the invention of agriculture some ten thousand years ago.  This allowed us to stay in one place and create ever improving technologies and tools.
  

• Every day we work and play using tools that have been developed over thousands of years. What we do almost every second is not down to our own achievements but our ancestors!
  

• Education – humans are the only animals that are not born with basic survival processes such as walking.  We are dependant on life long learning to achieve what we are all capable of. 

• Some concepts and actions need to be learnt at a very early stage, (some by 3 months old, many by 3 years old), as the brain is not able to develop them later.  The long-term achievement of societies and individuals is therefore firmly based on the quality of education for each individual.

• Energy production has been key for the progress of the human race. There are only 4 basic energy sources on earth:-

• The Sun - this also includes all the fossil fuels which are effectively stored sunlight and the energy from the wind and rain (eg wind farms and hydroelectric power)
• The Tides (from the pull of the moon)
• Geothermal - the heat from within the earth (it is thought there is a nuclear rector near the centre that produces heat and keep the centre hot)
• Nuclear (both fission - splitting of atoms as in current nuclear power stations, and fusion that is being experimented on in ITER)

• The total energy every day hitting the earth from the sun is (unbelievably!) about 20 THOUSAND times more than ALL the energy humans use each day (including transport, food, electricity, heating etc).

• The future energy sources that can provide as much energy as we shall ever want (for thousands of years ahead) are:
  
  
  • Thorium fission reactors (safe and cheap fuel) - but we need to develop them
  • Solar (it takes just 300Km by 300Km area to power the whole world at current levels of technology)
  • Wind, but this is a variable energy source
  • Geothermal - but not all the world can tap into this source.
  • (And possibly fusion reactors if we can get them to work)

• Future? With seven billion people to feed, clothe and house, we must continue to harness the efficiencies that improving technology affords us to maintain modern societies.  If we can (ever) manage to find new political and social structures to allow us to move away from our base human societal instincts, then Humans may well continue for a long time and move out to the stars. (see Emerging Technologies)

 

Personal Development Aid Download Here (Powerpoint)